Transcript: Human NM_001100878.2

Homo sapiens maestro heat like repeat family member 6 (MROH6), mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
MROH6 (642475)
Length:
3265
CDS:
59..2218

Additional Resources:

NCBI RefSeq record:
NM_001100878.2
NBCI Gene record:
MROH6 (642475)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001100878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269501 AGCCGTAACCAGCGTGTAAAT pLKO_005 689 CDS 100% 13.200 18.480 N MROH6 n/a
2 TRCN0000269499 CTAGGATGCCTGCCTGGAAAT pLKO_005 3045 3UTR 100% 10.800 7.560 N MROH6 n/a
3 TRCN0000269447 TCACGGCTATGGCCTTCTTCA pLKO_005 1191 CDS 100% 4.950 3.465 N MROH6 n/a
4 TRCN0000269500 CATGCCCAAGATTTGGGTTCT pLKO_005 910 CDS 100% 4.050 2.835 N MROH6 n/a
5 TRCN0000269445 CCAAGTCCTGGGAGGTCAAAC pLKO_005 192 CDS 100% 3.600 2.520 N MROH6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001100878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.