Transcript: Human NM_001101320.1

Homo sapiens serpin family E member 3 (SERPINE3), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
SERPINE3 (647174)
Length:
1441
CDS:
61..1335

Additional Resources:

NCBI RefSeq record:
NM_001101320.1
NBCI Gene record:
SERPINE3 (647174)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001101320.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263006 CTCCGTGAAGGAATGACATTG pLKO_005 124 CDS 100% 10.800 8.640 N SERPINE3 n/a
2 TRCN0000263010 GAGCAAGTCAGTGCAGCATTT pLKO_005 589 CDS 100% 10.800 8.640 N SERPINE3 n/a
3 TRCN0000263007 AGATTTCTTGCATGCTGTTTA pLKO_005 330 CDS 100% 13.200 9.240 N SERPINE3 n/a
4 TRCN0000263009 GCCACAGCTCTGTTGTTATTG pLKO_005 1141 CDS 100% 13.200 9.240 N SERPINE3 n/a
5 TRCN0000263008 GTAGAAATGAGACGAACTTTG pLKO_005 191 CDS 100% 10.800 7.560 N SERPINE3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101320.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.