Transcript: Human NM_001101417.4

Homo sapiens CDP-L-ribitol pyrophosphorylase A (CRPPA), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CRPPA (729920)
Length:
5592
CDS:
217..1422

Additional Resources:

NCBI RefSeq record:
NM_001101417.4
NBCI Gene record:
CRPPA (729920)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001101417.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262306 TATGCGGCTGAATCGATTATT pLKO_005 877 CDS 100% 15.000 21.000 N CRPPA n/a
2 TRCN0000262307 GAAGATCAGATCAACTCTAAA pLKO_005 631 CDS 100% 13.200 18.480 N CRPPA n/a
3 TRCN0000262305 TCTTAGATCAATGCTACAATT pLKO_005 1058 CDS 100% 13.200 18.480 N CRPPA n/a
4 TRCN0000262304 GCTTGAAGAGAGTAGTCTTTG pLKO_005 1137 CDS 100% 10.800 8.640 N CRPPA n/a
5 TRCN0000262303 TAAGGCAAGGTGCTATCATTA pLKO_005 1343 CDS 100% 13.200 9.240 N CRPPA n/a
6 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2616 3UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101417.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.