Transcript: Human NM_001101421.3

Homo sapiens myosin IH (MYO1H), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
MYO1H (283446)
Length:
4276
CDS:
1..3069

Additional Resources:

NCBI RefSeq record:
NM_001101421.3
NBCI Gene record:
MYO1H (283446)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001101421.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160828 CCGAAAGTGCTTCAGCTAATT pLKO.1 2602 CDS 100% 13.200 18.480 N MYO1H n/a
2 TRCN0000159323 GCAACTCATTCTTACTCAGAA pLKO.1 2694 CDS 100% 4.950 3.960 N MYO1H n/a
3 TRCN0000160482 CAGCTAATTAGCCATGAGAAA pLKO.1 2614 CDS 100% 4.950 3.465 N MYO1H n/a
4 TRCN0000162403 CGGATAGATGAAGGAGACATT pLKO.1 2578 CDS 100% 4.950 3.465 N MYO1H n/a
5 TRCN0000161922 GCTCCGTATAATCTCACCTTT pLKO.1 3871 3UTR 100% 4.950 3.465 N MYO1H n/a
6 TRCN0000161656 GCTGGTTAAGAAGGAGAACAT pLKO.1 2904 CDS 100% 4.950 3.465 N MYO1H n/a
7 TRCN0000159602 GAAGGAGACATTAATCCGAAA pLKO.1 2587 CDS 100% 4.050 2.835 N MYO1H n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101421.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.