Transcript: Mouse NM_001101605.1

Mus musculus interferon induced protein with tetratricpeptide repeats 1B like 1 (Ifit1bl1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-02
Taxon:
Mus musculus (mouse)
Gene:
Ifit1bl1 (667373)
Length:
2215
CDS:
48..1460

Additional Resources:

NCBI RefSeq record:
NM_001101605.1
NBCI Gene record:
Ifit1bl1 (667373)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001101605.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271042 AGTAACTTGGAAGATCATATT pLKO_005 1149 CDS 100% 13.200 9.240 N Ifit1bl1 n/a
2 TRCN0000271041 TGGCACTTCGCTCCAACATTT pLKO_005 638 CDS 100% 13.200 9.240 N Ifit1bl1 n/a
3 TRCN0000347703 CCTATCGCCTGGATCACATTG pLKO_005 616 CDS 100% 10.800 7.560 N Ifit1bl1 n/a
4 TRCN0000271102 GCCATAAGAAACGACTGATTC pLKO_005 922 CDS 100% 10.800 7.560 N Ifit1bl1 n/a
5 TRCN0000271103 TGGCCTTTATTCATTACTAAG pLKO_005 2009 3UTR 100% 10.800 6.480 N Ifit1bl1 n/a
6 TRCN0000201368 GCAGCCATCACACATTACTTA pLKO.1 1230 CDS 100% 5.625 2.813 Y Ifit1bl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101605.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.