Transcript: Human NM_001101662.1

Homo sapiens nardilysin convertase (NRDC), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
NRDC (4898)
Length:
3836
CDS:
323..3778

Additional Resources:

NCBI RefSeq record:
NM_001101662.1
NBCI Gene record:
NRDC (4898)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001101662.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414038 GTGGCACAGCTGGAGTATAAA pLKO_005 2555 CDS 100% 15.000 21.000 N NRDC n/a
2 TRCN0000431869 GAATATGCCCGTTGGTCTATG pLKO_005 2786 CDS 100% 10.800 15.120 N NRDC n/a
3 TRCN0000418982 GGCCATTTAACGGATCCATTT pLKO_005 1562 CDS 100% 10.800 15.120 N NRDC n/a
4 TRCN0000051650 GCGTTACTACTCTTCTCATTA pLKO.1 1435 CDS 100% 13.200 10.560 N NRDC n/a
5 TRCN0000051651 CCAGGAGTCTAAGAGAATATA pLKO.1 3105 CDS 100% 15.000 10.500 N NRDC n/a
6 TRCN0000433516 TGAACTGTGGAATAGTAATTT pLKO_005 2245 CDS 100% 15.000 10.500 N NRDC n/a
7 TRCN0000425794 GAAACAGAATACCCAGTTAAA pLKO_005 2348 CDS 100% 13.200 9.240 N NRDC n/a
8 TRCN0000051649 CCATCTAATTTCACCGTTGAT pLKO.1 2446 CDS 100% 4.950 3.465 N NRDC n/a
9 TRCN0000051648 CCTAAGTAATATGGAAGGTAA pLKO.1 709 CDS 100% 4.950 3.465 N NRDC n/a
10 TRCN0000051652 CCTCTACTGTTTCAGCTCATT pLKO.1 2633 CDS 100% 4.950 3.465 N NRDC n/a
11 TRCN0000136024 GATGAAGAAGAAGAGGAGGAA pLKO.1 749 CDS 100% 2.640 1.320 Y GRWD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101662.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.