Transcript: Mouse NM_001102400.1

Mus musculus disabled 2, mitogen-responsive phosphoprotein (Dab2), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Dab2 (13132)
Length:
3803
CDS:
284..1867

Additional Resources:

NCBI RefSeq record:
NM_001102400.1
NBCI Gene record:
Dab2 (13132)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001102400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337795 CCATTAGTCGTCGATCTTAAA pLKO_005 752 CDS 100% 13.200 18.480 N Dab2 n/a
2 TRCN0000380731 TCGCTCCAGCTTTGACGTATT pLKO_005 1962 3UTR 100% 10.800 15.120 N Dab2 n/a
3 TRCN0000337794 ACTATGGCTTTACGTAAATTA pLKO_005 2063 3UTR 100% 15.000 12.000 N Dab2 n/a
4 TRCN0000337869 TGGTCCCAGGAGCCATAATAA pLKO_005 1131 CDS 100% 15.000 10.500 N Dab2 n/a
5 TRCN0000183022 CCCTTGAAACTTCCAGAATAT pLKO.1 2152 3UTR 100% 13.200 9.240 N Dab2 n/a
6 TRCN0000337796 GAACATGAACATCCAGTAAAT pLKO_005 620 CDS 100% 13.200 9.240 N Dab2 n/a
7 TRCN0000381604 GGTGAAGGCCAGCATCAATTT pLKO_005 701 CDS 100% 13.200 9.240 N Dab2 n/a
8 TRCN0000184217 GCCCTAATGACCCTTGATGAT pLKO.1 866 CDS 100% 4.950 3.465 N Dab2 n/a
9 TRCN0000183752 CTCCAGTTACTTCAACAATAA pLKO.1 1606 CDS 100% 13.200 7.920 N Dab2 n/a
10 TRCN0000337792 CTCCAGTTACTTCAACAATAA pLKO_005 1606 CDS 100% 13.200 7.920 N Dab2 n/a
11 TRCN0000379626 TTGATGATCAAGCTAACAAAT pLKO_005 879 CDS 100% 13.200 7.920 N Dab2 n/a
12 TRCN0000195959 CCAGCAGTACAAGTCTGGAAT pLKO.1 1199 CDS 100% 4.950 2.970 N Dab2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001102400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.