Transcript: Mouse NM_001102436.1

Mus musculus acyl-Coenzyme A binding domain containing 5 (Acbd5), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Acbd5 (74159)
Length:
3616
CDS:
180..1598

Additional Resources:

NCBI RefSeq record:
NM_001102436.1
NBCI Gene record:
Acbd5 (74159)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001102436.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246868 ACTGCTTCGCAGGCGAAATTA pLKO_005 1422 CDS 100% 15.000 21.000 N Acbd5 n/a
2 TRCN0000246867 ATTGTTACCAATGGCTATAAA pLKO_005 744 CDS 100% 15.000 10.500 N Acbd5 n/a
3 TRCN0000215426 GGATCCTATTGGAAGATATAA pLKO.1 353 CDS 100% 15.000 10.500 N Acbd5 n/a
4 TRCN0000246870 GGATCCTATTGGAAGATATAA pLKO_005 353 CDS 100% 15.000 10.500 N Acbd5 n/a
5 TRCN0000432358 GGATCCTATTGGAAGATATAA pLKO_005 353 CDS 100% 15.000 10.500 N ACBD5 n/a
6 TRCN0000246869 TTGAGCTTGAAGGACTAAATT pLKO_005 1847 3UTR 100% 15.000 10.500 N Acbd5 n/a
7 TRCN0000215425 GGATCATTCCAACCAACAAAT pLKO.1 255 CDS 100% 13.200 9.240 N Acbd5 n/a
8 TRCN0000246866 GATCGCTCTTGTGCTCATTAG pLKO_005 1346 CDS 100% 10.800 7.560 N Acbd5 n/a
9 TRCN0000200767 GATGCTTAAGTTCTATAGCTT pLKO.1 281 CDS 100% 3.000 2.100 N Acbd5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001102436.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.