Transcript: Human NM_001103146.2

Homo sapiens GRB10 interacting GYF protein 2 (GIGYF2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
GIGYF2 (26058)
Length:
7788
CDS:
172..4071

Additional Resources:

NCBI RefSeq record:
NM_001103146.2
NBCI Gene record:
GIGYF2 (26058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001103146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277089 TGCCCTTAATACGGCAAATAA pLKO_005 3603 CDS 100% 15.000 21.000 N Gigyf2 n/a
2 TRCN0000136361 CACAGTACACTCCATTCAGTA pLKO.1 3877 CDS 100% 4.950 6.930 N GIGYF2 n/a
3 TRCN0000133747 CAGGAAGAATTGTTACGCAAA pLKO.1 2677 CDS 100% 4.050 5.670 N GIGYF2 n/a
4 TRCN0000136339 GCAACAAATCACAGAACCGAT pLKO.1 4171 3UTR 100% 2.640 3.696 N GIGYF2 n/a
5 TRCN0000134463 GCATGAATTTATACGCTCAGA pLKO.1 750 CDS 100% 2.640 3.696 N GIGYF2 n/a
6 TRCN0000135088 CGGGAGCAAGAAATTGCATTA pLKO.1 2563 CDS 100% 10.800 8.640 N GIGYF2 n/a
7 TRCN0000414322 AGCAATGCAGAAGTGGTATTA pLKO_005 1764 CDS 100% 13.200 9.240 N GIGYF2 n/a
8 TRCN0000413048 TGATTATATCAGGGCCTATTT pLKO_005 3684 CDS 100% 13.200 9.240 N GIGYF2 n/a
9 TRCN0000135151 CGCATCTTTAGAGAGGAACAA pLKO.1 784 CDS 100% 4.950 3.465 N GIGYF2 n/a
10 TRCN0000138937 GCAACCAAACAGAGCTCGTAA pLKO.1 3243 CDS 100% 4.950 3.465 N GIGYF2 n/a
11 TRCN0000133792 CCATTCAGTATTTCAGACCAA pLKO.1 3888 CDS 100% 2.640 1.848 N GIGYF2 n/a
12 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 7467 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001103146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.