Transcript: Mouse NM_001104531.1

Mus musculus cytochrome P450, family 2, subfamily d, polypeptide 11 (Cyp2d11), mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Cyp2d11 (545123)
Length:
1590
CDS:
76..1590

Additional Resources:

NCBI RefSeq record:
NM_001104531.1
NBCI Gene record:
Cyp2d11 (545123)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001104531.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254964 CTTAATGAGTTCCCAATATTC pLKO_005 754 CDS 100% 13.200 18.480 N Cyp2d11 n/a
2 TRCN0000267536 TTCACCGTCATCTTCATATTA pLKO_005 118 CDS 100% 15.000 9.000 N Cyp2d11 n/a
3 TRCN0000254966 ACTTCGGCCTGGGCAAGAAAT pLKO_005 506 CDS 100% 13.200 6.600 Y Cyp2d11 n/a
4 TRCN0000254965 AGGAAATCGATGCGGTCATAG pLKO_005 1082 CDS 100% 10.800 5.400 Y Cyp2d11 n/a
5 TRCN0000127171 CAATGGACTGAAGGCAATGAA pLKO.1 327 CDS 100% 5.625 2.813 Y Cyp2d10 n/a
6 TRCN0000126472 CCCTACACCAATGCTGTCATT pLKO.1 1144 CDS 100% 4.950 2.475 Y Cyp2d9 n/a
7 TRCN0000174036 CGCATCACAAGTCGTGACATT pLKO.1 1210 CDS 100% 4.950 2.475 Y Cyp2d12 n/a
8 TRCN0000127173 CTTTGAATATGAAGACCCTTA pLKO.1 666 CDS 100% 4.050 2.025 Y Cyp2d10 n/a
9 TRCN0000126473 GCTTTGAATATGAAGACCCTT pLKO.1 665 CDS 100% 2.640 1.320 Y Cyp2d9 n/a
10 TRCN0000175033 GCTTTGAATATGAAGACCCTT pLKO.1 665 CDS 100% 2.640 1.320 Y Cyp2d12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001104531.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.