Transcript: Mouse NM_001105061.1

Mus musculus predicted gene 9268 (Gm9268), mRNA.

Source:
NCBI, updated 2012-08-15
Taxon:
Mus musculus (mouse)
Gene:
Gm9268 (668612)
Length:
2565
CDS:
1..2565

Additional Resources:

NCBI RefSeq record:
NM_001105061.1
NBCI Gene record:
Gm9268 (668612)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001105061.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000297081 GGGCTGCAATCAACTAATTAA pLKO_005 354 CDS 100% 15.000 21.000 N Gm9268 n/a
2 TRCN0000272090 CCCAACGGGTCTTGGATTAAA pLKO_005 1407 CDS 100% 15.000 7.500 Y Gm9268 n/a
3 TRCN0000272093 CCCATTGTCAAGGCCAATAAT pLKO_005 1834 CDS 100% 15.000 7.500 Y Gm9268 n/a
4 TRCN0000234159 ACCCATTGTCAAGGCCAATAA pLKO_005 1833 CDS 100% 13.200 6.600 Y Vmn2r-ps60 n/a
5 TRCN0000272091 GATTTGAGCATCATAACATTA pLKO_005 305 CDS 100% 13.200 6.600 Y Gm9268 n/a
6 TRCN0000027986 CTCAGTTGCTTGCTCTACATT pLKO.1 1900 CDS 100% 5.625 2.813 Y Vmn2r57 n/a
7 TRCN0000028007 GCAGTTGCTTTCCACTGTGTA pLKO.1 2221 CDS 100% 4.950 2.475 Y Vmn2r57 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001105061.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.