Transcript: Human NM_001105243.2

Homo sapiens protocadherin 19 (PCDH19), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCDH19 (57526)
Length:
9615
CDS:
1677..4982

Additional Resources:

NCBI RefSeq record:
NM_001105243.2
NBCI Gene record:
PCDH19 (57526)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001105243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412768 TTGACTCCAACTACGTGAATA pLKO_005 4168 CDS 100% 13.200 18.480 N PCDH19 n/a
2 TRCN0000119164 CCTTCCGTGTCTTACACCATT pLKO.1 4770 CDS 100% 4.950 6.930 N PCDH19 n/a
3 TRCN0000119162 CCGGGTAATAAGACCCTTATT pLKO.1 8429 3UTR 100% 1.320 1.848 N PCDH19 n/a
4 TRCN0000433434 CAATGGAAATCTGCGTGATAA pLKO_005 2002 CDS 100% 13.200 9.240 N PCDH19 n/a
5 TRCN0000436706 TCACTGTCACTGGCGCTTTAG pLKO_005 2569 CDS 100% 10.800 7.560 N PCDH19 n/a
6 TRCN0000119163 CCTCTTTGTAACTATGATCTT pLKO.1 3749 CDS 100% 4.950 3.465 N PCDH19 n/a
7 TRCN0000119166 GAACATCATCGCGCTGTCTAT pLKO.1 4499 CDS 100% 4.950 3.465 N PCDH19 n/a
8 TRCN0000252394 CAGTCTCTGTTGCTGATTATA pLKO_005 9315 3UTR 100% 15.000 9.000 N Pcdh19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001105243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.