Transcript: Human NM_001105568.3

Homo sapiens kinesin family member 13A (KIF13A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KIF13A (63971)
Length:
7096
CDS:
173..5422

Additional Resources:

NCBI RefSeq record:
NM_001105568.3
NBCI Gene record:
KIF13A (63971)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001105568.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117283 GCACTCATTAAACGACGAGAA pLKO.1 3434 CDS 100% 4.050 5.670 N KIF13A n/a
2 TRCN0000377368 TTAACGAACTTCTGGTTTATT pLKO_005 1545 CDS 100% 15.000 12.000 N KIF13A n/a
3 TRCN0000364980 GGTAGCGAAAGAGTATCTAAA pLKO_005 935 CDS 100% 13.200 10.560 N KIF13A n/a
4 TRCN0000117285 GCCGTCCTCAAACAAAGAGTT pLKO.1 4963 CDS 100% 4.950 3.960 N KIF13A n/a
5 TRCN0000364981 ACTCATTAAACGACGAGAATA pLKO_005 3436 CDS 100% 13.200 9.240 N KIF13A n/a
6 TRCN0000364983 GGAAACCTCCCAAGGTATTTG pLKO_005 318 CDS 100% 13.200 9.240 N KIF13A n/a
7 TRCN0000117284 CCCAAGGTATTTGCCTTTGAT pLKO.1 326 CDS 100% 5.625 3.938 N KIF13A n/a
8 TRCN0000117286 GCAACATTAACAAATCGCTTA pLKO.1 990 CDS 100% 4.050 2.835 N KIF13A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001105568.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.