Transcript: Mouse NM_001109897.2

Mus musculus transient receptor potential cation channel, subfamily C, member 2 (Trpc2), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Trpc2 (22064)
Length:
3342
CDS:
57..2729

Additional Resources:

NCBI RefSeq record:
NM_001109897.2
NBCI Gene record:
Trpc2 (22064)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001109897.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070062 GCCAATGTCAAATTCGACTTT pLKO.1 315 CDS 100% 4.950 2.475 Y Trpc2 n/a
2 TRCN0000070058 GCCTTCTTTGACTCATCGATT pLKO.1 459 CDS 100% 4.950 2.475 Y Trpc2 n/a
3 TRCN0000070059 CGGCATCTTTACCATCGTCAT pLKO.1 1913 CDS 100% 4.050 2.025 Y Trpc2 n/a
4 TRCN0000070061 GCCTGAGTTTAAGCCTCAGTA pLKO.1 779 CDS 100% 0.495 0.248 Y Trpc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001109897.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.