Transcript: Mouse NM_001109914.1

Mus musculus apolipoprotein L domain containing 1 (Apold1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Apold1 (381823)
Length:
3284
CDS:
33..773

Additional Resources:

NCBI RefSeq record:
NM_001109914.1
NBCI Gene record:
Apold1 (381823)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001109914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252570 TAAACTGTAGTTGGCGTATAT pLKO_005 2409 3UTR 100% 13.200 18.480 N Apold1 n/a
2 TRCN0000252572 AGAGCATCCTCTACCTATATG pLKO_005 773 CDS 100% 13.200 9.240 N Apold1 n/a
3 TRCN0000252571 CTCTCTGATCTTCTGCAATTC pLKO_005 347 CDS 100% 10.800 7.560 N Apold1 n/a
4 TRCN0000252569 GATCTGGACGCAGCGTTGTTT pLKO_005 747 CDS 100% 5.625 3.938 N Apold1 n/a
5 TRCN0000252568 CTGTCTACTTCATCGTCTTCT pLKO_005 523 CDS 100% 4.950 3.465 N Apold1 n/a
6 TRCN0000005616 CTGAAGGCCAAGATTCAGAAA pLKO.1 609 CDS 100% 0.495 0.347 N APOLD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001109914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.