Transcript: Human NM_001109974.3

Homo sapiens synaptopodin (SYNPO), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SYNPO (11346)
Length:
6484
CDS:
528..2585

Additional Resources:

NCBI RefSeq record:
NM_001109974.3
NBCI Gene record:
SYNPO (11346)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001109974.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230911 CATGCTAGAGAGACGACATTT pLKO_005 1301 CDS 100% 13.200 18.480 N SYNPO n/a
2 TRCN0000230913 GAGGTCTCCTCCCTCATATTC pLKO_005 1529 CDS 100% 13.200 18.480 N SYNPO n/a
3 TRCN0000008655 CCGCAAATCCATGTTTACTTT pLKO.1 1655 CDS 100% 5.625 7.875 N SYNPO n/a
4 TRCN0000008657 CACTCCTAATTGACAAGGTAT pLKO.1 988 CDS 100% 4.950 6.930 N SYNPO n/a
5 TRCN0000008654 CCCTCATATTCTGTCCTGTAT pLKO.1 1539 CDS 100% 4.950 3.465 N SYNPO n/a
6 TRCN0000218782 ACCACTGGTGGTTTATCTAAA pLKO_005 599 CDS 100% 13.200 7.920 N SYNPO n/a
7 TRCN0000230912 CCGGCCACAGAGACACATAAT pLKO_005 1373 CDS 100% 13.200 7.920 N SYNPO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001109974.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.