Transcript: Mouse NM_001110195.1

Mus musculus enoyl Coenzyme A hydratase domain containing 1 (Echdc1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Echdc1 (52665)
Length:
2946
CDS:
135..1034

Additional Resources:

NCBI RefSeq record:
NM_001110195.1
NBCI Gene record:
Echdc1 (52665)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110195.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249154 TTTATGAGACTACCGTTAATA pLKO_005 537 CDS 100% 15.000 21.000 N Echdc1 n/a
2 TRCN0000249155 AGTGGAGTGGCCTTATCTATG pLKO_005 492 CDS 100% 10.800 8.640 N Echdc1 n/a
3 TRCN0000249151 ACTTACTACAGCATGTGATTT pLKO_005 602 CDS 100% 13.200 9.240 N Echdc1 n/a
4 TRCN0000217214 CAAACAGGAGTGTCGCTTTAT pLKO.1 186 CDS 100% 13.200 9.240 N Echdc1 n/a
5 TRCN0000249152 CAAACAGGAGTGTCGCTTTAT pLKO_005 186 CDS 100% 13.200 9.240 N Echdc1 n/a
6 TRCN0000249153 CATTGGCATTCTGACGCTAAA pLKO_005 299 CDS 100% 10.800 7.560 N Echdc1 n/a
7 TRCN0000433408 AGTTTCCTGGTGGATCCATTG pLKO_005 256 CDS 100% 6.000 4.200 N ECHDC1 n/a
8 TRCN0000192691 GCCCATTGATAGCTTCTCTTT pLKO.1 2286 3UTR 100% 4.950 3.465 N Echdc1 n/a
9 TRCN0000191025 CCTGCAAATTTAGAGGCTATT pLKO.1 987 CDS 100% 10.800 6.480 N Echdc1 n/a
10 TRCN0000190080 GCCTCATTATCCATGGAGCAA pLKO.1 412 CDS 100% 2.640 1.584 N Echdc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110195.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.