Transcript: Human NM_001110199.3

Homo sapiens serine/arginine repetitive matrix 3 (SRRM3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
SRRM3 (222183)
Length:
3617
CDS:
212..2173

Additional Resources:

NCBI RefSeq record:
NM_001110199.3
NBCI Gene record:
SRRM3 (222183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001110199.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161972 GCATAGGATAACATGTGCTTT pLKO.1 3237 3UTR 100% 4.950 6.930 N SRRM3 n/a
2 TRCN0000165018 GAACAAAGAGCCGTTACGAAC pLKO.1 2420 3UTR 100% 4.050 5.670 N SRRM3 n/a
3 TRCN0000166585 CAAAGAGCCGTTACGAACACA pLKO.1 2423 3UTR 100% 3.000 4.200 N SRRM3 n/a
4 TRCN0000165120 CCGTTACGAACACAGGAATCT pLKO.1 2430 3UTR 100% 4.950 3.960 N SRRM3 n/a
5 TRCN0000164669 CGTTACGAACACAGGAATCTC pLKO.1 2431 3UTR 100% 4.950 3.960 N SRRM3 n/a
6 TRCN0000165767 CATGTGCTTTGGACCTGACAA pLKO.1 3248 3UTR 100% 4.950 3.465 N SRRM3 n/a
7 TRCN0000166323 CTGCTCTGTCACTTCACCTTA pLKO.1 2527 3UTR 100% 4.950 3.465 N SRRM3 n/a
8 TRCN0000163375 GTACATTTGACCCTGAGGTTA pLKO.1 2985 3UTR 100% 4.950 3.465 N SRRM3 n/a
9 TRCN0000165163 GCAAAGTCGTTCACTGACTGA pLKO.1 3078 3UTR 100% 2.640 1.848 N SRRM3 n/a
10 TRCN0000166016 GACAGAAGGAAGAACAGCCTA pLKO.1 2680 3UTR 100% 2.640 1.584 N SRRM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110199.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.