Transcript: Mouse NM_001110780.1

Mus musculus synapsin I (Syn1), transcript variant b, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Mus musculus (mouse)
Gene:
Syn1 (20964)
Length:
3211
CDS:
130..2142

Additional Resources:

NCBI RefSeq record:
NM_001110780.1
NBCI Gene record:
Syn1 (20964)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110780.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093301 CCAGTGTAAACTCTTTGCATT pLKO.1 761 CDS 100% 4.950 6.930 N Syn1 n/a
2 TRCN0000093299 CCTCAGTATGTCCCTTGAGAA pLKO.1 2341 3UTR 100% 4.950 6.930 N Syn1 n/a
3 TRCN0000093303 CACGTAATGGAGACTACCGAA pLKO.1 707 CDS 100% 2.640 3.696 N Syn1 n/a
4 TRCN0000093300 CCCTTCATTGATGCTAAATAT pLKO.1 1045 CDS 100% 15.000 10.500 N Syn1 n/a
5 TRCN0000093302 GATCAGACTTTCTATCCTAAT pLKO.1 871 CDS 100% 10.800 7.560 N Syn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110780.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.