Transcript: Mouse NM_001111277.1

Mus musculus eukaryotic translation initiation factor 2B, subunit 3 (Eif2b3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Eif2b3 (108067)
Length:
1565
CDS:
80..1438

Additional Resources:

NCBI RefSeq record:
NM_001111277.1
NBCI Gene record:
Eif2b3 (108067)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001111277.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252626 CATCGGGCCAGATACACAAAT pLKO_005 1150 CDS 100% 13.200 18.480 N Eif2b3 n/a
2 TRCN0000267422 GAAGCACCCTAGGATACATTT pLKO_005 643 CDS 100% 13.200 18.480 N Eif2b3 n/a
3 TRCN0000252624 ATACGAGACAGAACGTCTATT pLKO_005 1220 CDS 100% 13.200 10.560 N Eif2b3 n/a
4 TRCN0000252625 AGACAAAGAAGAGGATCTAAA pLKO_005 820 CDS 100% 13.200 9.240 N Eif2b3 n/a
5 TRCN0000267417 GGATGAAGAGCTGGTCATTAA pLKO_005 607 CDS 100% 13.200 9.240 N Eif2b3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001111277.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.