Transcript: Mouse NM_001111296.2

Mus musculus sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 (Sult2a1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Sult2a1 (20859)
Length:
1021
CDS:
55..912

Additional Resources:

NCBI RefSeq record:
NM_001111296.2
NBCI Gene record:
Sult2a1 (20859)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001111296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103365 GAAATGTTCTATTCGGATCAT pLKO.1 521 CDS 100% 4.950 3.960 N Sult2a2 n/a
2 TRCN0000255089 GCGATCTATCTCGTGAGAAAT pLKO_005 400 CDS 100% 13.200 7.920 N Sult2a1 n/a
3 TRCN0000255087 CAAGCTGAAGCCTTCGATAAA pLKO_005 838 CDS 100% 13.200 6.600 Y Sult2a1 n/a
4 TRCN0000255091 TAGAGACTGATATAGGATATT pLKO_005 287 CDS 100% 13.200 6.600 Y Sult2a1 n/a
5 TRCN0000255088 TTGGAAGATATTCGTAATAAG pLKO_005 121 CDS 100% 13.200 6.600 Y Sult2a1 n/a
6 TRCN0000281711 CCAAGCTGAAGCCTTCGATAA pLKO_005 837 CDS 100% 10.800 5.400 Y Sult2a4 n/a
7 TRCN0000255090 GATCCAAACTGTGCCCATTTG pLKO_005 249 CDS 100% 10.800 5.400 Y Sult2a1 n/a
8 TRCN0000103369 CATGAGAGAATGGGACAACTT pLKO.1 570 CDS 100% 4.950 2.475 Y Sult2a2 n/a
9 TRCN0000103367 GCCATATCATATCAAAGAGAA pLKO.1 97 CDS 100% 4.950 2.475 Y Sult2a2 n/a
10 TRCN0000270326 TTTGGAAGATATTCGTAATAG pLKO_005 120 CDS 100% 13.200 6.600 Y Sult2a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001111296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.