Transcript: Mouse NM_001113208.1

Mus musculus neural cell adhesion molecule 2 (Ncam2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ncam2 (17968)
Length:
3590
CDS:
218..2731

Additional Resources:

NCBI RefSeq record:
NM_001113208.1
NBCI Gene record:
Ncam2 (17968)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001113208.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113641 GCTCCTAAGTTTGTTTCAAAT pLKO.1 1415 CDS 100% 13.200 18.480 N Ncam2 n/a
2 TRCN0000436770 GGATGGCCGCATCGAAGTTAA pLKO_005 1267 CDS 100% 13.200 18.480 N Ncam2 n/a
3 TRCN0000113642 GCACAAGATTTCAGGAATATA pLKO.1 1662 CDS 100% 15.000 10.500 N Ncam2 n/a
4 TRCN0000417464 GGGAAATAAAGACCACATTAT pLKO_005 2152 CDS 100% 13.200 9.240 N Ncam2 n/a
5 TRCN0000151912 CACAAGAAGCTACAGTAGTTT pLKO.1 522 CDS 100% 5.625 3.938 N NCAM2 n/a
6 TRCN0000152098 CACTTAGCAAAGTAGAGCTTA pLKO.1 294 CDS 100% 4.950 3.465 N NCAM2 n/a
7 TRCN0000113644 CCAGCTAAGAATACGACTCAT pLKO.1 1541 CDS 100% 4.950 3.465 N Ncam2 n/a
8 TRCN0000113643 GCAGAGGGTTATGCTACAGAA pLKO.1 409 CDS 100% 4.950 3.465 N Ncam2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113208.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.