Transcript: Human NM_001113349.2

Homo sapiens endothelin converting enzyme 1 (ECE1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ECE1 (1889)
Length:
5026
CDS:
18..2321

Additional Resources:

NCBI RefSeq record:
NM_001113349.2
NBCI Gene record:
ECE1 (1889)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001113349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046941 GATCAATGAATCCGAGCCTAT pLKO.1 1088 CDS 100% 4.050 5.670 N ECE1 n/a
2 TRCN0000415551 GAGATCATCCTGGAGATTAAG pLKO_005 1404 CDS 100% 13.200 9.240 N ECE1 n/a
3 TRCN0000438378 ACTACTCGCCCACCAAGAATG pLKO_005 1711 CDS 100% 10.800 7.560 N ECE1 n/a
4 TRCN0000427615 TGTCTATGTCAGTGCCGATTC pLKO_005 722 CDS 100% 6.000 4.200 N ECE1 n/a
5 TRCN0000046942 GCAGTTCCAGACCTCTACTTT pLKO.1 1581 CDS 100% 5.625 3.938 N ECE1 n/a
6 TRCN0000031173 CAAGGAGTTCTCAGAACACTT pLKO.1 2246 CDS 100% 4.950 3.465 N Ece1 n/a
7 TRCN0000352007 CAAGGAGTTCTCAGAACACTT pLKO_005 2246 CDS 100% 4.950 3.465 N Ece1 n/a
8 TRCN0000046940 CCTCTCCAATTCCAAGGAGTT pLKO.1 2234 CDS 100% 4.050 2.835 N ECE1 n/a
9 TRCN0000046939 GCCTTAAACTTTGGTGGCATA pLKO.1 1791 CDS 100% 4.050 2.835 N ECE1 n/a
10 TRCN0000046938 GCCGATGAGAAGTTCATGGAA pLKO.1 1245 CDS 100% 3.000 2.100 N ECE1 n/a
11 TRCN0000438423 TGGTGTTGGCTCTCAACGTGA pLKO_005 2468 3UTR 100% 2.640 1.848 N ECE1 n/a
12 TRCN0000031170 CCAACAGAGATCAGTGGAGTA pLKO.1 1666 CDS 100% 4.050 2.835 N Ece1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.