Transcript: Mouse NM_001113401.1

Mus musculus ELL associated factor 2 (Eaf2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Eaf2 (106389)
Length:
1888
CDS:
104..892

Additional Resources:

NCBI RefSeq record:
NM_001113401.1
NBCI Gene record:
Eaf2 (106389)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001113401.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176132 GATGTCTCCAACGTCTCTAAT pLKO.1 550 CDS 100% 13.200 18.480 N Eaf2 n/a
2 TRCN0000174463 CCTATCTGATATGCCTTAAAT pLKO.1 1263 3UTR 100% 15.000 12.000 N Eaf2 n/a
3 TRCN0000173940 GATGCTACTTGTCACCGACTT pLKO.1 791 CDS 100% 4.050 2.835 N Eaf2 n/a
4 TRCN0000175928 GAGAACTGAAAGCAGAAGCTA pLKO.1 585 CDS 100% 3.000 2.100 N Eaf2 n/a
5 TRCN0000005293 GCTATGACTTCAAACCTGCTT pLKO.1 207 CDS 100% 2.640 1.848 N EAF2 n/a
6 TRCN0000193208 CATCTTCAAGTAGTGAGGATA pLKO.1 660 CDS 100% 4.950 2.970 N Eaf2 n/a
7 TRCN0000193580 GCAAGATAGATGTCAGTGTTA pLKO.1 1427 3UTR 100% 4.950 2.970 N Eaf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113401.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.