Transcript: Mouse NM_001113408.1

Mus musculus LIM domain binding 1 (Ldb1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Ldb1 (16825)
Length:
2110
CDS:
358..1593

Additional Resources:

NCBI RefSeq record:
NM_001113408.1
NBCI Gene record:
Ldb1 (16825)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001113408.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238801 ATGGTAACCAAACCGACTATA pLKO_005 545 CDS 100% 13.200 18.480 N Ldb1 n/a
2 TRCN0000021788 GCGGATAAAGACGTGGCACTT pLKO.1 933 CDS 100% 4.050 5.670 N LDB1 n/a
3 TRCN0000096343 CACACACCATATGGTAACCAA pLKO.1 535 CDS 100% 0.000 0.000 N Ldb1 n/a
4 TRCN0000233349 TGACGACATGATGCGGATAAA pLKO_005 921 CDS 100% 13.200 10.560 N Ldb1 n/a
5 TRCN0000096341 CACGCTACTTCCGAAGCATTT pLKO.1 731 CDS 100% 10.800 8.640 N Ldb1 n/a
6 TRCN0000233347 CACGCTACTTCCGAAGCATTT pLKO_005 731 CDS 100% 10.800 8.640 N Ldb1 n/a
7 TRCN0000021785 CGACGAGGACAGCTTTAACAA pLKO.1 1476 CDS 100% 5.625 4.500 N LDB1 n/a
8 TRCN0000275573 CGACGAGGACAGCTTTAACAA pLKO_005 1476 CDS 100% 5.625 4.500 N LDB1 n/a
9 TRCN0000233348 AGCACGGCAAACCCATGTTTA pLKO_005 857 CDS 100% 13.200 9.240 N Ldb1 n/a
10 TRCN0000275510 GGATGGACCAAAGAGATATAC pLKO_005 690 CDS 100% 13.200 9.240 N LDB1 n/a
11 TRCN0000021786 GCTGTCCAATTCCACTCTCAA pLKO.1 1059 CDS 100% 4.950 3.465 N LDB1 n/a
12 TRCN0000096340 GCTTAACAAACGGCTACAGAA pLKO.1 576 CDS 100% 4.950 3.465 N Ldb1 n/a
13 TRCN0000096342 CCAAGAGAGCAAATCGGAGAA pLKO.1 1548 CDS 100% 4.050 2.835 N Ldb1 n/a
14 TRCN0000233350 GGGAGCAGAAGACGGAATAAA pLKO_005 1646 3UTR 100% 15.000 9.000 N Ldb1 n/a
15 TRCN0000096339 AGGGAGCAGAAGACGGAATAA pLKO.1 1645 3UTR 100% 13.200 7.920 N Ldb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113408.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.