Transcript: Human NM_001113534.2

Homo sapiens folate receptor beta (FOLR2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
FOLR2 (2350)
Length:
1106
CDS:
151..918

Additional Resources:

NCBI RefSeq record:
NM_001113534.2
NBCI Gene record:
FOLR2 (2350)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001113534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372332 ACCTGCCCTCAGCTTGGATAA pLKO_005 937 3UTR 100% 10.800 7.560 N FOLR2 n/a
2 TRCN0000372333 CTTCCTGGATGTGCCCTTATG pLKO_005 516 CDS 100% 10.800 7.560 N FOLR2 n/a
3 TRCN0000060480 CCTCTGGAGTCACTCATACAA pLKO.1 705 CDS 100% 5.625 3.938 N FOLR2 n/a
4 TRCN0000060481 CTGGACCTCAGGAGTTAACAA pLKO.1 615 CDS 100% 5.625 3.938 N FOLR2 n/a
5 TRCN0000060479 CTCCTCAATGTCTGTATGGAT pLKO.1 229 CDS 100% 3.000 2.100 N FOLR2 n/a
6 TRCN0000372273 TCTGTGTAGCCACCATGTGCA pLKO_005 188 CDS 100% 2.640 1.848 N FOLR2 n/a
7 TRCN0000060482 ACAAGCTGCATGACCAATGCA pLKO.1 284 CDS 100% 0.300 0.210 N FOLR2 n/a
8 TRCN0000060530 CCGCTGCATCCAGATGTGGTT pLKO.1 753 CDS 100% 0.880 0.440 Y FOLR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.