Transcript: Human NM_001114171.2

Homo sapiens FosB proto-oncogene, AP-1 transcription factor subunit (FOSB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
FOSB (2354)
Length:
3667
CDS:
592..1500

Additional Resources:

NCBI RefSeq record:
NM_001114171.2
NBCI Gene record:
FOSB (2354)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001114171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424014 ATCGGACAGGAGGATTCCTTG pLKO_005 1658 3UTR 100% 4.050 3.240 N FOSB n/a
2 TRCN0000414745 CCTCGCTCTGTGAACTCTTTA pLKO_005 1488 CDS 100% 13.200 9.240 N FOSB n/a
3 TRCN0000016068 GCCAACCACAATTCAATGAAT pLKO.1 3501 3UTR 100% 5.625 3.938 N FOSB n/a
4 TRCN0000016069 CCTTCGTACACTTCTTCGTTT pLKO.1 1375 CDS 100% 4.950 3.465 N FOSB n/a
5 TRCN0000085201 CTCTTTACACACAGTGAAGTT pLKO.1 1321 CDS 100% 4.950 2.970 N Fosb n/a
6 TRCN0000016071 GCCGAGTCTCAATATCTGTCT pLKO.1 652 CDS 100% 2.640 1.584 N FOSB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.