Transcript: Human NM_001114632.2

Homo sapiens jumonji domain containing 7 (JMJD7), mRNA.

Source:
NCBI, updated 2019-05-19
Taxon:
Homo sapiens (human)
Gene:
JMJD7 (100137047)
Length:
1409
CDS:
34..984

Additional Resources:

NCBI RefSeq record:
NM_001114632.2
NBCI Gene record:
JMJD7 (100137047)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001114632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263134 TACGACCTCAAGTATAGTTAC pLKO_005 919 CDS 100% 10.800 15.120 N JMJD7 n/a
2 TRCN0000263136 GATCTTGGAATGTGGTCATAA pLKO_005 1127 3UTR 100% 13.200 9.240 N JMJD7 n/a
3 TRCN0000282501 GGGCTGCATCGCAGTGAATTT pLKO_005 882 CDS 100% 13.200 9.240 N JMJD7 n/a
4 TRCN0000263135 GCCGGTGAGATGCTCTATCTG pLKO_005 826 CDS 100% 1.650 1.155 N JMJD7 n/a
5 TRCN0000263133 GACTGATGGAGCACTGGTGAA pLKO_005 979 CDS 100% 4.050 2.430 N JMJD7 n/a
6 TRCN0000379754 CTTTGCACAAGGACCACTATG pLKO_005 560 CDS 100% 10.800 5.400 Y JMJD7-PLA2G4B n/a
7 TRCN0000007114 CTAACTGAAGAGGGCACCTTT pLKO.1 685 CDS 100% 4.950 2.475 Y JMJD7-PLA2G4B n/a
8 TRCN0000284878 CTAACTGAAGAGGGCACCTTT pLKO_005 685 CDS 100% 4.950 2.475 Y JMJD7-PLA2G4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.