Transcript: Human NM_001114633.1

Homo sapiens phospholipase A2 group IVB (PLA2G4B), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
PLA2G4B (100137049)
Length:
2752
CDS:
102..2447

Additional Resources:

NCBI RefSeq record:
NM_001114633.1
NBCI Gene record:
PLA2G4B (100137049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001114633.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272883 GATCCCAGTGGTAGCTATTAT pLKO_005 980 CDS 100% 15.000 7.500 Y JMJD7-PLA2G4B n/a
2 TRCN0000350863 GGCCCAGGCCACACATAATTT pLKO_005 1799 CDS 100% 15.000 7.500 Y PLA2G4B n/a
3 TRCN0000337417 AGATCCCAGTGGTAGCTATTA pLKO_005 979 CDS 100% 13.200 6.600 Y PLA2G4B n/a
4 TRCN0000337416 ATGTTGGCTACCTCATCAATA pLKO_005 1945 CDS 100% 13.200 6.600 Y PLA2G4B n/a
5 TRCN0000272882 CAACCTCCAGGACAGCTTATA pLKO_005 1622 CDS 100% 13.200 6.600 Y JMJD7-PLA2G4B n/a
6 TRCN0000380530 GCCCAGGCCACACATAATTTC pLKO_005 1800 CDS 100% 13.200 6.600 Y JMJD7-PLA2G4B n/a
7 TRCN0000337414 GGCGCCTGGAAGTTGAATTTC pLKO_005 460 CDS 100% 13.200 6.600 Y PLA2G4B n/a
8 TRCN0000272943 ATTTCCACAAAGACTACTTTC pLKO_005 1834 CDS 100% 10.800 5.400 Y JMJD7-PLA2G4B n/a
9 TRCN0000007116 CCTCACTTCTCCACATGGAAA pLKO.1 1860 CDS 100% 4.950 2.475 Y JMJD7-PLA2G4B n/a
10 TRCN0000314689 GTTGCAGGTGGGAACTGTCAT pLKO_005 2498 3UTR 100% 4.950 2.475 Y JMJD7-PLA2G4B n/a
11 TRCN0000337415 TGCAGGTGGGAACTGTCATCA pLKO_005 2500 3UTR 100% 4.950 2.475 Y PLA2G4B n/a
12 TRCN0000007113 CCTCATCCTGTCATTGGACTA pLKO.1 2006 CDS 100% 4.050 2.025 Y JMJD7-PLA2G4B n/a
13 TRCN0000007115 CAGCTCAAGAATGTCATGGAA pLKO.1 312 CDS 100% 3.000 1.500 Y JMJD7-PLA2G4B n/a
14 TRCN0000007112 CCTAACTCTCATTCATTCCCT pLKO.1 2468 3UTR 100% 0.750 0.375 Y JMJD7-PLA2G4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114633.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.