Transcript: Human NM_001115007.3

Homo sapiens lin-54 DREAM MuvB core complex component (LIN54), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
LIN54 (132660)
Length:
5268
CDS:
183..1769

Additional Resources:

NCBI RefSeq record:
NM_001115007.3
NBCI Gene record:
LIN54 (132660)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001115007.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107669 CCCAATGTCCAGCAGATTCAA pLKO.1 555 CDS 100% 5.625 7.875 N LIN54 n/a
2 TRCN0000436288 CACCTTTGAAATCGCCAAATA pLKO_005 448 CDS 100% 13.200 9.240 N LIN54 n/a
3 TRCN0000107665 GCAGACAGAATGTTACATAAA pLKO.1 2178 3UTR 100% 13.200 9.240 N LIN54 n/a
4 TRCN0000095106 GCTTCCATTCAATGGCATAAT pLKO.1 1037 CDS 100% 13.200 9.240 N Lin54 n/a
5 TRCN0000433888 GTCATAGCAAAGGGTGTAATT pLKO_005 1300 CDS 100% 13.200 9.240 N LIN54 n/a
6 TRCN0000107668 GCCTAAGATAGGGAAAGGAAA pLKO.1 1259 CDS 100% 4.950 3.465 N LIN54 n/a
7 TRCN0000107667 CGGCTTCCATTCAATGGCATA pLKO.1 1035 CDS 100% 4.050 2.835 N LIN54 n/a
8 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 4473 3UTR 100% 4.950 2.475 Y ORAI2 n/a
9 TRCN0000073413 CGCCTGTAATTCCAGCACTTT pLKO.1 4395 3UTR 100% 4.950 2.475 Y LILRB1 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2963 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2963 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001115007.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.