Transcript: Human NM_001122731.2

Homo sapiens microtubule associated monooxygenase, calponin and LIM domain containing 3 (MICAL3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
MICAL3 (57553)
Length:
3105
CDS:
75..2975

Additional Resources:

NCBI RefSeq record:
NM_001122731.2
NBCI Gene record:
MICAL3 (57553)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001122731.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046575 CCCTGAGAATGTGAGTAAGAA pLKO.1 1430 CDS 100% 5.625 7.875 N MICAL3 n/a
2 TRCN0000046576 CCTGACTCAGTTCTACGAGAT pLKO.1 1919 CDS 100% 4.050 5.670 N MICAL3 n/a
3 TRCN0000046577 CCATTCACCATACATGATCTA pLKO.1 465 CDS 100% 4.950 3.960 N MICAL3 n/a
4 TRCN0000046574 CCTATCTCCTTCCTAAGCAAA pLKO.1 2022 CDS 100% 4.950 3.465 N MICAL3 n/a
5 TRCN0000046573 CGGAAAGAATTCCGTGGCAAA pLKO.1 774 CDS 100% 0.000 0.000 N MICAL3 n/a
6 TRCN0000432041 GGCAGTCACAAAGACTACAAA pLKO_005 291 CDS 100% 5.625 3.375 N Mical3 n/a
7 TRCN0000426699 ATGCCTTCTCCCGCAACAATG pLKO_005 430 CDS 100% 10.800 7.560 N Mical3 n/a
8 TRCN0000042111 GCCAAGGTGGTTGTTATTGAA pLKO.1 402 CDS 100% 5.625 3.375 N Mical3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122731.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.