Transcript: Mouse NM_001122954.1

Mus musculus phospholipase A2, group V (Pla2g5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pla2g5 (18784)
Length:
2140
CDS:
427..840

Additional Resources:

NCBI RefSeq record:
NM_001122954.1
NBCI Gene record:
Pla2g5 (18784)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001122954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076902 CAGATGCACGACCGTTGTTAT pLKO.1 619 CDS 100% 13.200 18.480 N Pla2g5 n/a
2 TRCN0000425507 GTCTACTGCCTGCGGAGAAAC pLKO_005 769 CDS 100% 3.600 5.040 N Pla2g5 n/a
3 TRCN0000417418 GAAGCCAAATTAACTCTATAA pLKO_005 1190 3UTR 100% 13.200 10.560 N Pla2g5 n/a
4 TRCN0000424546 ACCCATTCTCAAGGCTAGAAA pLKO_005 1236 3UTR 100% 5.625 4.500 N Pla2g5 n/a
5 TRCN0000076900 CAACCCTCTTTACCAGTATTA pLKO.1 801 CDS 100% 13.200 9.240 N Pla2g5 n/a
6 TRCN0000076899 CCAGTCCTATGACTACAGATA pLKO.1 675 CDS 100% 4.950 3.465 N Pla2g5 n/a
7 TRCN0000222633 GCTAGAACTCAAGTCCATGAT pLKO.1 492 CDS 100% 4.950 3.465 N Pla2g5 n/a
8 TRCN0000414794 ATCTGCGAACACGACTCCTTC pLKO_005 712 CDS 100% 4.050 2.835 N Pla2g5 n/a
9 TRCN0000076898 GCAAGAGAATCGGGAGTTCAA pLKO.1 1681 3UTR 100% 4.950 2.475 Y Pla2g5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.