Transcript: Mouse NM_001122959.1

Mus musculus RAD54 like (S. cerevisiae) (Rad54l), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rad54l (19366)
Length:
2742
CDS:
275..2518

Additional Resources:

NCBI RefSeq record:
NM_001122959.1
NBCI Gene record:
Rad54l (19366)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001122959.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273787 GTCGTGCTGGTGTCTAATTAT pLKO_005 1820 CDS 100% 15.000 10.500 N Rad54l n/a
2 TRCN0000273789 CCACCTGGTTATAACTCTAAA pLKO_005 1718 CDS 100% 13.200 9.240 N Rad54l n/a
3 TRCN0000012216 CCCAGAATGCAAGCCAGAAAT pLKO.1 886 CDS 100% 13.200 9.240 N Rad54l n/a
4 TRCN0000012214 GCAGTCAACATGAAGCATTTA pLKO.1 474 CDS 100% 13.200 9.240 N Rad54l n/a
5 TRCN0000273788 GCAGTCAACATGAAGCATTTA pLKO_005 474 CDS 100% 13.200 9.240 N Rad54l n/a
6 TRCN0000012215 CCTCTCTAAAGAAGCTGTGTA pLKO.1 1626 CDS 100% 4.950 3.465 N Rad54l n/a
7 TRCN0000012213 GCTGGTCTGGATGTAGTTGTT pLKO.1 2525 3UTR 100% 4.950 3.465 N Rad54l n/a
8 TRCN0000273738 GCTGGTCTGGATGTAGTTGTT pLKO_005 2525 3UTR 100% 4.950 3.465 N Rad54l n/a
9 TRCN0000000233 GTCCATTAAGAAGCGAGCCAA pLKO.1 1915 CDS 100% 2.640 1.848 N RAD54L n/a
10 TRCN0000012217 GCCCATGAATTCAAGAAGCAT pLKO.1 1322 CDS 100% 0.000 0.000 N Rad54l n/a
11 TRCN0000281997 GCCCATGAATTCAAGAAGCAT pLKO_005 1322 CDS 100% 0.000 0.000 N Rad54l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122959.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.