Transcript: Human NM_001126108.2

Homo sapiens solute carrier family 12 member 3 (SLC12A3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
SLC12A3 (6559)
Length:
5540
CDS:
30..3095

Additional Resources:

NCBI RefSeq record:
NM_001126108.2
NBCI Gene record:
SLC12A3 (6559)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001126108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042941 GATTACGAAGAACAGAGTCAA pLKO.1 2864 CDS 100% 4.950 6.930 N SLC12A3 n/a
2 TRCN0000415897 GGCGTGAATCTTGACAGTTTC pLKO_005 3441 3UTR 100% 10.800 8.640 N SLC12A3 n/a
3 TRCN0000413463 ATGATGCAGGCGCACATTAAC pLKO_005 2382 CDS 100% 13.200 9.240 N SLC12A3 n/a
4 TRCN0000042938 CAGGAGAGAAAGGCGATCATT pLKO.1 2649 CDS 100% 5.625 3.938 N SLC12A3 n/a
5 TRCN0000042939 GAGACCTTCATTCCAATACTA pLKO.1 1703 CDS 100% 5.625 3.938 N SLC12A3 n/a
6 TRCN0000042942 CATCAACTATTACCAGACCAT pLKO.1 1349 CDS 100% 2.640 1.848 N SLC12A3 n/a
7 TRCN0000042940 GTGCCCACATATGAGCACTAT pLKO.1 219 CDS 100% 0.000 0.000 N SLC12A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001126108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.