Transcript: Human NM_001127222.2

Homo sapiens calcium voltage-gated channel subunit alpha1 A (CACNA1A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CACNA1A (773)
Length:
8647
CDS:
256..7776

Additional Resources:

NCBI RefSeq record:
NM_001127222.2
NBCI Gene record:
CACNA1A (773)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127222.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013651 CCCTCAGGTTATTGCGTATTT pLKO.1 2003 CDS 100% 13.200 18.480 N CACNA1A n/a
2 TRCN0000420881 ACAACGTGCTGCGATACTTTG pLKO_005 4073 CDS 100% 10.800 15.120 N CACNA1A n/a
3 TRCN0000013649 GCAGCAATAATGACGGTGTTT pLKO.1 2218 CDS 100% 4.950 6.930 N CACNA1A n/a
4 TRCN0000430744 ATGGTGTTCTCCATCTATTTC pLKO_005 2314 CDS 100% 13.200 9.240 N CACNA1A n/a
5 TRCN0000429727 TCCGTGACCTCTGGAATATTC pLKO_005 4178 CDS 100% 13.200 9.240 N CACNA1A n/a
6 TRCN0000013652 CGGGAGTGGAAGAAGTATGAA pLKO.1 4552 CDS 100% 5.625 3.938 N CACNA1A n/a
7 TRCN0000013650 CCACTTCAATTCCACCCTCAT pLKO.1 5925 CDS 100% 4.050 2.835 N CACNA1A n/a
8 TRCN0000013648 CCTCAACATCTGGTACCAGCA pLKO.1 7067 CDS 100% 0.000 0.000 N CACNA1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127222.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.