Transcript: Human NM_001127228.2

Homo sapiens chromobox 1 (CBX1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CBX1 (10951)
Length:
2182
CDS:
249..806

Additional Resources:

NCBI RefSeq record:
NM_001127228.2
NBCI Gene record:
CBX1 (10951)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380617 TGGCTATTACTGGTGTATTAT pLKO_005 1215 3UTR 100% 15.000 21.000 N CBX1 n/a
2 TRCN0000379986 GCAGCAGCCCAAGTGCTTTAA pLKO_005 942 3UTR 100% 13.200 9.240 N CBX1 n/a
3 TRCN0000062223 CCCGACCTCATTGCTGAGTTT pLKO.1 429 CDS 100% 4.950 3.465 N CBX1 n/a
4 TRCN0000290148 CCCGACCTCATTGCTGAGTTT pLKO_005 429 CDS 100% 4.950 3.465 N CBX1 n/a
5 TRCN0000062227 CCTCCTAAAGTGGAAGGGATT pLKO.1 362 CDS 100% 4.050 2.835 N CBX1 n/a
6 TRCN0000290149 CCTCCTAAAGTGGAAGGGATT pLKO_005 362 CDS 100% 4.050 2.835 N CBX1 n/a
7 TRCN0000062224 CCCACAGGTTGTCATATCCTT pLKO.1 716 CDS 100% 3.000 2.100 N CBX1 n/a
8 TRCN0000290222 CCCACAGGTTGTCATATCCTT pLKO_005 716 CDS 100% 3.000 2.100 N CBX1 n/a
9 TRCN0000062225 GAAGAGGAATATGTGGTGGAA pLKO.1 300 CDS 100% 2.640 1.848 N CBX1 n/a
10 TRCN0000290220 GAAGAGGAATATGTGGTGGAA pLKO_005 300 CDS 100% 2.640 1.848 N CBX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.