Transcript: Human NM_001127487.2

Homo sapiens filamin C (FLNC), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FLNC (2318)
Length:
9060
CDS:
233..8311

Additional Resources:

NCBI RefSeq record:
NM_001127487.2
NBCI Gene record:
FLNC (2318)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127487.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238997 ACACTCGCAATGCAGGTTATG pLKO_005 6327 CDS 100% 10.800 15.120 N Flnc n/a
2 TRCN0000062482 ACCTTCACTATTGTCACCAAA pLKO.1 5768 CDS 100% 4.950 6.930 N FLNC n/a
3 TRCN0000291355 ACCTTCACTATTGTCACCAAA pLKO_005 5768 CDS 100% 4.950 6.930 N FLNC n/a
4 TRCN0000062481 CGGTACCTTTGACATCTACTA pLKO.1 5329 CDS 100% 0.000 0.000 N FLNC n/a
5 TRCN0000291357 CGGTACCTTTGACATCTACTA pLKO_005 5329 CDS 100% 0.000 0.000 N FLNC n/a
6 TRCN0000062479 CGGTGTGTCATCAGAGTTCAT pLKO.1 7693 CDS 100% 4.950 3.960 N FLNC n/a
7 TRCN0000291354 CGGTGTGTCATCAGAGTTCAT pLKO_005 7693 CDS 100% 4.950 3.960 N FLNC n/a
8 TRCN0000062478 GCTAAGGTGGTTCCCAACAAT pLKO.1 1202 CDS 100% 5.625 3.938 N FLNC n/a
9 TRCN0000291353 GCTAAGGTGGTTCCCAACAAT pLKO_005 1202 CDS 100% 5.625 3.938 N FLNC n/a
10 TRCN0000062480 CCAGATAAGGTGAAGGCCTTT pLKO.1 2231 CDS 100% 4.050 2.835 N FLNC n/a
11 TRCN0000291356 CCAGATAAGGTGAAGGCCTTT pLKO_005 2231 CDS 100% 4.050 2.835 N FLNC n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8368 3UTR 100% 4.950 2.475 Y KAAG1 n/a
13 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 8372 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127487.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.