Transcript: Human NM_001127648.2

Homo sapiens gamma-aminobutyric acid type A receptor alpha1 subunit (GABRA1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
GABRA1 (2554)
Length:
4006
CDS:
87..1457

Additional Resources:

NCBI RefSeq record:
NM_001127648.2
NBCI Gene record:
GABRA1 (2554)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127648.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426817 TGTTGTTATGACCACTCATTT pLKO_005 797 CDS 100% 13.200 18.480 N GABRA1 n/a
2 TRCN0000061150 CCTCCGGTTAAATAACCTAAT pLKO.1 416 CDS 100% 10.800 15.120 N GABRA1 n/a
3 TRCN0000061149 CCCGCTGCTATTTGGAATCTT pLKO.1 1367 CDS 100% 5.625 7.875 N GABRA1 n/a
4 TRCN0000061151 CCGACTGTCAAGAATAGCCTT pLKO.1 1346 CDS 100% 2.640 3.696 N GABRA1 n/a
5 TRCN0000061148 CCGTCATTACAAGATGAACTT pLKO.1 171 CDS 100% 4.950 3.960 N GABRA1 n/a
6 TRCN0000426972 AGTAAAGGATCCTCTTATTAA pLKO_005 1154 CDS 100% 15.000 10.500 N GABRA1 n/a
7 TRCN0000435388 GTCTACTGGGCTACGTATTTA pLKO_005 1395 CDS 100% 15.000 10.500 N GABRA1 n/a
8 TRCN0000437097 AGGATTGGGAGAGCGTGTAAC pLKO_005 263 CDS 100% 10.800 6.480 N GABRA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127648.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.