Transcript: Mouse NM_001128093.1

Mus musculus seven in absentia homolog 3 (Drosophila) (Siah3), mRNA.

Source:
NCBI, updated 2017-05-03
Taxon:
Mus musculus (mouse)
Gene:
Siah3 (380918)
Length:
905
CDS:
75..881

Additional Resources:

NCBI RefSeq record:
NM_001128093.1
NBCI Gene record:
Siah3 (380918)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001128093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092249 CCCACGCACAACCTAAAGTAT pLKO.1 192 CDS 100% 5.625 7.875 N Siah3 n/a
2 TRCN0000092251 CTCAGGTGACACCCTGTATAT pLKO.1 373 CDS 100% 13.200 10.560 N Siah3 n/a
3 TRCN0000092252 CTCAGGAAACAGGAACGACAT pLKO.1 579 CDS 100% 4.050 3.240 N Siah3 n/a
4 TRCN0000092250 GCAACTTGTCTGTGTGGTCAA pLKO.1 170 CDS 100% 4.050 2.835 N Siah3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.