Transcript: Mouse NM_001128171.2

Mus musculus CYLD lysine 63 deubiquitinase (Cyld), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Cyld (74256)
Length:
8148
CDS:
357..3215

Additional Resources:

NCBI RefSeq record:
NM_001128171.2
NBCI Gene record:
Cyld (74256)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001128171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362571 TGTTACTTAGACTCAACTTTA pLKO_005 2145 CDS 100% 13.200 18.480 N Cyld n/a
2 TRCN0000030990 GCCCAATACTAATGGCAGCAT pLKO.1 1622 CDS 100% 2.640 3.696 N Cyld n/a
3 TRCN0000030989 GCAGCCTGTTTCCAATCAAAT pLKO.1 1988 CDS 100% 13.200 10.560 N Cyld n/a
4 TRCN0000362562 AGACTGTAACTTCTATCAAAT pLKO_005 2474 CDS 100% 13.200 9.240 N Cyld n/a
5 TRCN0000030993 CCCTGGACACTGTGTTACTTA pLKO.1 2191 CDS 100% 5.625 3.938 N Cyld n/a
6 TRCN0000030991 GCAGTTATTAGAATGGTCTTT pLKO.1 2537 CDS 100% 4.950 3.465 N Cyld n/a
7 TRCN0000030992 GCATTGGACAAACTAGAACTT pLKO.1 948 CDS 100% 4.950 3.465 N Cyld n/a
8 TRCN0000018366 GAAGAAGGTCGTGGTCAAGGT pLKO.1 861 CDS 100% 2.640 1.848 N CYLD n/a
9 TRCN0000362561 AGGAGAGGCTCAGCCTATTTA pLKO_005 676 CDS 100% 15.000 9.000 N Cyld n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.