Transcript: Mouse NM_001128307.1

Mus musculus dedicator of cytokinesis 9 (Dock9), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Dock9 (105445)
Length:
8221
CDS:
468..6635

Additional Resources:

NCBI RefSeq record:
NM_001128307.1
NBCI Gene record:
Dock9 (105445)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001128307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253065 TACGTTGCATCTGAGTATAAG pLKO_005 3264 CDS 100% 13.200 18.480 N Dock9 n/a
2 TRCN0000253069 TTGGCGATGGATCCTATAATC pLKO_005 1120 CDS 100% 13.200 18.480 N Dock9 n/a
3 TRCN0000253067 TAAATCTCACTGGCAATATTT pLKO_005 6945 3UTR 100% 15.000 10.500 N Dock9 n/a
4 TRCN0000253066 ATGGCGAGGATTCACGTTAAA pLKO_005 5355 CDS 100% 13.200 9.240 N Dock9 n/a
5 TRCN0000253068 GAACGTGACACGGGTCATTAT pLKO_005 3161 CDS 100% 13.200 9.240 N Dock9 n/a
6 TRCN0000142217 GCAGAATATCTCACACGGAAA pLKO.1 5430 CDS 100% 4.050 2.835 N DOCK9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.