Transcript: Human NM_001128310.2

Homo sapiens SPARC like 1 (SPARCL1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
SPARCL1 (8404)
Length:
3012
CDS:
573..2567

Additional Resources:

NCBI RefSeq record:
NM_001128310.2
NBCI Gene record:
SPARCL1 (8404)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373560 CAACCTATGCACCAGGTATTT pLKO_005 2712 3UTR 100% 13.200 18.480 N SPARCL1 n/a
2 TRCN0000373631 ATACCCAATCTGATGATATTT pLKO_005 1282 CDS 100% 15.000 10.500 N SPARCL1 n/a
3 TRCN0000055755 CCCGACAAATGCAAGATTATT pLKO.1 623 CDS 100% 15.000 10.500 N SPARCL1 n/a
4 TRCN0000423421 GGCCACTGCTTTGGAATTAAA pLKO_005 2514 CDS 100% 15.000 10.500 N Sparcl1 n/a
5 TRCN0000373632 TGAACACGCTGGTTATCTAAA pLKO_005 2201 CDS 100% 13.200 9.240 N SPARCL1 n/a
6 TRCN0000055753 CCCACAATGATAACCAAGAAA pLKO.1 1210 CDS 100% 5.625 3.938 N SPARCL1 n/a
7 TRCN0000055756 CCTGTCATCTATTCGCTACTA pLKO.1 2017 CDS 100% 4.950 3.465 N SPARCL1 n/a
8 TRCN0000055757 GCAAATCTATTCCTACTTGTA pLKO.1 2098 CDS 100% 4.950 3.465 N SPARCL1 n/a
9 TRCN0000055754 GCAGAGAAATAAAGTCAAGAA pLKO.1 2228 CDS 100% 4.950 3.465 N SPARCL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.