Transcript: Human NM_001128608.2

Homo sapiens mitogen-activated protein kinase binding protein 1 (MAPKBP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MAPKBP1 (23005)
Length:
7200
CDS:
237..4781

Additional Resources:

NCBI RefSeq record:
NM_001128608.2
NBCI Gene record:
MAPKBP1 (23005)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052658 CCGATCAGGTTTAGTTGCTTA pLKO.1 413 CDS 100% 4.950 6.930 N MAPKBP1 n/a
2 TRCN0000052660 CGGAACAACCTATTCACTGAT pLKO.1 924 CDS 100% 4.950 6.930 N MAPKBP1 n/a
3 TRCN0000052659 CCCTTGAGACTTCACTCACTA pLKO.1 2947 CDS 100% 4.950 3.465 N MAPKBP1 n/a
4 TRCN0000052661 CCTTGACCTTTGATCCTACTA pLKO.1 1282 CDS 100% 4.950 3.465 N MAPKBP1 n/a
5 TRCN0000052662 CCAGCATGACATGATCGTCAA pLKO.1 698 CDS 100% 4.050 2.835 N MAPKBP1 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6379 3UTR 100% 13.200 6.600 Y LIAS n/a
7 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 6453 3UTR 100% 4.950 2.475 Y LOC339059 n/a
8 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 6543 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.