Transcript: Human NM_001129820.2

Homo sapiens schlafen family member 14 (SLFN14), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
SLFN14 (342618)
Length:
7169
CDS:
177..2915

Additional Resources:

NCBI RefSeq record:
NM_001129820.2
NBCI Gene record:
SLFN14 (342618)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001129820.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254760 CTAGAATTATCCGGGCTATAT pLKO_005 304 CDS 100% 13.200 18.480 N SLFN14 n/a
2 TRCN0000254759 TGCCGTATCCTGAGGTAATAG pLKO_005 205 CDS 100% 13.200 18.480 N SLFN14 n/a
3 TRCN0000265611 AGTGAATCCTGACTTACTAAA pLKO_005 959 CDS 100% 13.200 10.560 N SLFN14 n/a
4 TRCN0000254758 ATAAGGAGAAACTCAACTTTA pLKO_005 769 CDS 100% 13.200 9.240 N SLFN14 n/a
5 TRCN0000267487 TGGTACTCTATACAATCTTAA pLKO_005 1576 CDS 100% 13.200 9.240 N SLFN14 n/a
6 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 6511 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001129820.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.