Transcript: Human NM_001130048.2

Homo sapiens dedicator of cytokinesis 9 (DOCK9), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
DOCK9 (23348)
Length:
7681
CDS:
156..6362

Additional Resources:

NCBI RefSeq record:
NM_001130048.2
NBCI Gene record:
DOCK9 (23348)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142216 GACTGGCATCTTGTGAACTAT pLKO.1 510 CDS 100% 5.625 7.875 N DOCK9 n/a
2 TRCN0000141621 CCAAAGTTAAGTTGCTGCGAA pLKO.1 3088 CDS 100% 2.640 3.696 N DOCK9 n/a
3 TRCN0000144498 CCTTAGGAAACGAACTTGTAA pLKO.1 2683 CDS 100% 5.625 4.500 N DOCK9 n/a
4 TRCN0000142185 GCCTTAGGAAACGAACTTGTA pLKO.1 2682 CDS 100% 4.950 3.960 N DOCK9 n/a
5 TRCN0000122687 GCGGTAAACGAACGTCTGATT pLKO.1 6246 CDS 100% 4.950 3.960 N DOCK9 n/a
6 TRCN0000140732 GCTTCCGAACAAAGTGGTCAA pLKO.1 563 CDS 100% 4.050 3.240 N DOCK9 n/a
7 TRCN0000139678 CCAACAGTGACCGGCTTATTA pLKO.1 4813 CDS 100% 15.000 10.500 N DOCK9 n/a
8 TRCN0000141047 CGCGAGCTTTCTTAGATGATA pLKO.1 6139 CDS 100% 5.625 3.938 N DOCK9 n/a
9 TRCN0000142706 CCAACATTGCTACTGAGGTTT pLKO.1 4333 CDS 100% 4.950 3.465 N DOCK9 n/a
10 TRCN0000142217 GCAGAATATCTCACACGGAAA pLKO.1 5088 CDS 100% 4.050 2.835 N DOCK9 n/a
11 TRCN0000122134 GCTGTTCCAGTATATGCAATA pLKO.1 7279 3UTR 100% 10.800 6.480 N DOCK9 n/a
12 TRCN0000140165 GTACCAGTGAACCAGGAGATT pLKO.1 6992 3UTR 100% 0.000 0.000 N DOCK9 n/a
13 TRCN0000253067 TAAATCTCACTGGCAATATTT pLKO_005 6674 3UTR 100% 15.000 10.500 N Dock9 n/a
14 TRCN0000253069 TTGGCGATGGATCCTATAATC pLKO_005 772 CDS 100% 13.200 9.240 N Dock9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.