Transcript: Mouse NM_001130693.3

Mus musculus guanylate cyclase 2d (Gucy2d), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Gucy2d (14918)
Length:
3633
CDS:
94..3447

Additional Resources:

NCBI RefSeq record:
NM_001130693.3
NBCI Gene record:
Gucy2d (14918)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001130693.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262939 TCGACAGCCATGATGTGTATA pLKO_005 2861 CDS 100% 13.200 18.480 N Gucy2d n/a
2 TRCN0000262941 CGACCAGGTCACCATCTATTT pLKO_005 2742 CDS 100% 13.200 9.240 N Gucy2d n/a
3 TRCN0000262942 GCTGGCTGTAGATCAAGTTAA pLKO_005 375 CDS 100% 13.200 9.240 N Gucy2d n/a
4 TRCN0000262943 ATGATCTCTACACGCTGTTTG pLKO_005 2831 CDS 100% 10.800 7.560 N Gucy2d n/a
5 TRCN0000262940 CACTCTTTGGAACTATCTATG pLKO_005 1163 CDS 100% 10.800 7.560 N Gucy2d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130693.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.