Transcript: Human NM_001130960.2

Homo sapiens phospholipase C eta 1 (PLCH1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
PLCH1 (23007)
Length:
6473
CDS:
305..5386

Additional Resources:

NCBI RefSeq record:
NM_001130960.2
NBCI Gene record:
PLCH1 (23007)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130960.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050082 GCCACGCATGAAGGCTTAAAT pLKO.1 1865 CDS 100% 15.000 21.000 N PLCH1 n/a
2 TRCN0000050079 CCGCATTGATTCCAGTAACTT pLKO.1 2284 CDS 100% 5.625 7.875 N PLCH1 n/a
3 TRCN0000050080 CCTGTGACATATTTAACCCAT pLKO.1 1161 CDS 100% 2.640 3.696 N PLCH1 n/a
4 TRCN0000050078 CGAGCCAAATTCAAGGCAAAT pLKO.1 2387 CDS 100% 10.800 7.560 N PLCH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130960.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.