Transcript: Human NM_001131018.2

Homo sapiens CDKN1A interacting zinc finger protein 1 (CIZ1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
CIZ1 (25792)
Length:
2735
CDS:
147..2603

Additional Resources:

NCBI RefSeq record:
NM_001131018.2
NBCI Gene record:
CIZ1 (25792)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001131018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154035 CAAACACCAGTTGTGGTTCAT pLKO.1 1338 CDS 100% 4.950 3.465 N CIZ1 n/a
2 TRCN0000292348 CAAACACCAGTTGTGGTTCAT pLKO_005 1338 CDS 100% 4.950 3.465 N CIZ1 n/a
3 TRCN0000151763 CACTCCAAATTTGCAACAGTT pLKO.1 503 CDS 100% 4.950 3.465 N CIZ1 n/a
4 TRCN0000292302 CACTCCAAATTTGCAACAGTT pLKO_005 503 CDS 100% 4.950 3.465 N CIZ1 n/a
5 TRCN0000155699 CCAAGTCAGCATGGAAGAGAT pLKO.1 1439 CDS 100% 4.950 3.465 N CIZ1 n/a
6 TRCN0000151866 CCAATCGAAAGGATTCTTCTT pLKO.1 652 CDS 100% 4.950 3.465 N CIZ1 n/a
7 TRCN0000154634 CCTCCAGTTCTTCTGCTACAT pLKO.1 1676 CDS 100% 4.950 3.465 N CIZ1 n/a
8 TRCN0000156000 CGTTTGCAACCGCTACTTCAA pLKO.1 1970 CDS 100% 4.950 3.465 N CIZ1 n/a
9 TRCN0000155162 GCACTTAGTGCTGCAACAGAA pLKO.1 1130 CDS 100% 4.950 3.465 N CIZ1 n/a
10 TRCN0000292350 GCACTTAGTGCTGCAACAGAA pLKO_005 1130 CDS 100% 4.950 3.465 N CIZ1 n/a
11 TRCN0000155369 CCACTTTGAGAACCTGCAGAA pLKO.1 2375 CDS 100% 4.050 2.835 N CIZ1 n/a
12 TRCN0000153258 GAGGATGATGAGGATGAAGAA pLKO.1 2148 CDS 100% 4.950 2.970 N CIZ1 n/a
13 TRCN0000292349 GAGGATGATGAGGATGAAGAA pLKO_005 2148 CDS 100% 4.950 2.970 N CIZ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001131018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.