Transcript: Human NM_001134363.3

Homo sapiens RNA binding motif protein 20 (RBM20), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
RBM20 (282996)
Length:
7293
CDS:
120..3803

Additional Resources:

NCBI RefSeq record:
NM_001134363.3
NBCI Gene record:
RBM20 (282996)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134363.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236599 ATCCTCATGAAGTCGACTAAT pLKO_005 1764 CDS 100% 13.200 10.560 N RBM20 n/a
2 TRCN0000236597 ACAGGCCATGGTCCAGTATTA pLKO_005 1820 CDS 100% 13.200 9.240 N RBM20 n/a
3 TRCN0000255358 CAATCAGAACCTTCGGTTTAA pLKO_005 6615 3UTR 100% 13.200 9.240 N RBM20 n/a
4 TRCN0000236598 TGGAAATGCCTGGCCTAAATC pLKO_005 3109 CDS 100% 13.200 9.240 N RBM20 n/a
5 TRCN0000370696 CAGCTACAGCAGGATTCTATG pLKO_005 787 CDS 100% 10.800 7.560 N RBM20 n/a
6 TRCN0000236596 CTCATGAGCTGAACGACTTTC pLKO_005 1306 CDS 100% 10.800 7.560 N RBM20 n/a
7 TRCN0000370784 TCTTGTTTCTCTCAATCTTTC pLKO_005 4041 3UTR 100% 10.800 7.560 N RBM20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134363.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.