Transcript: Human NM_001134663.2

Homo sapiens sterile alpha motif domain containing 13 (SAMD13), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SAMD13 (148418)
Length:
1459
CDS:
127..435

Additional Resources:

NCBI RefSeq record:
NM_001134663.2
NBCI Gene record:
SAMD13 (148418)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134663.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139063 CCTTCCCATGCTATCTGTTGA pLKO.1 120 5UTR 100% 4.950 6.930 N SAMD13 n/a
2 TRCN0000140126 GCTTGTGTTACTTGGACGGAA pLKO.1 891 3UTR 100% 2.640 3.696 N SAMD13 n/a
3 TRCN0000143750 CCTGCTATTGATGACAAGAAA pLKO.1 309 CDS 100% 5.625 3.938 N SAMD13 n/a
4 TRCN0000141268 CCATCCATATTCAGCTAGCTT pLKO.1 1067 3UTR 100% 3.000 2.100 N SAMD13 n/a
5 TRCN0000143704 GATGTCGTCAATTATTTCCGA pLKO.1 229 CDS 100% 0.750 0.525 N SAMD13 n/a
6 TRCN0000143641 CTCTGCAGACAAAGCATTTAA pLKO.1 398 CDS 100% 15.000 9.000 N SAMD13 n/a
7 TRCN0000139728 CCGTGATGGATGTCGTCAATT pLKO.1 221 CDS 100% 13.200 7.920 N SAMD13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134663.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.